UM171 is an asymmetric assembly to degrade the CoREST corepressors

Read Time:28 Minute, 38 Second

Study of Low Passage PDX Cells in Mice and Adults at St. Jude Children’s Research Hospital for Human Studies (SJCRH)

Drug treatments and a tandem-mass-tag study were performed at St. Jude Children’s Research Hospital. NSG mice (NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ; The Jackson Laboratory, JAX catalogue no. 005557) were used as hosts for PDX studies. Female NSG mice at least 8 weeks of age were anaesthetized in a surgical suite, and dissociated PDX cells were implanted in the cerebellum to amplify tumour material for downstream analyses. Mice were observed daily and euthanized at the onset of signs of sickness, including lethargy and neurological abnormalities. All clinical signs at the time of euthanasia did not exceed humane end point as determined by the SJCRH Institutional Animal Care and Use Committee (IACUC protocol no. 589-100536). RCMB51, RCMB52 and RCMB28 were created and shared by R.J. Wechsler-Reya. ICB1299 and ICB1572 were originated and shared by X.-N. Li, Northwestern University Feinberg School of Medicine (previously Baylor University). MED411FH, MED411FH-TC (established for tissue culture), MED211FH and MED2312FH were purchased from the Brain Tumor Research Laboratory, Seattle Children’s Hospital (previously Fred Hutchinson)44. Low passage PDXs (less than 10) were dissected and then flash-frozen for proteomics or dissociated for transduction and/or ex vivo drug sensitivity screening. The size of the sample was made to correlate with the number of dissociated tumours in the model. Randomization of samples or blinding was not done.

MV4;11 and SET-2 (50 million cells per replicate) were treated with 1 µM UM171 or DMSO for 6 h. Cells were washed twice with ice-cold PBS and snap-frozen in liquid nitrogen for storage at −80 °C until use (n = 3, biological replicates). Frozen cell pellets were lysed in DPBS (Thermo Fisher Scientific) supplemented with benzonase (Santacruz Biotechnology) and protease inhibitor cocktail (Roche) using a chilled bath sonicator at 4 °C (Q700, QSonica). The lysates were clarified by centrifugation at 300g for 3 min. Proteins were quantified by BCA assay (Thermo Fisher Scientific) and normalized to 200 µg per 150 µl. Then, 200 µg of protein was reduced with 5 mM Tris(2-carboxyethyl) phosphine hydrochloride (TCEP) (Sigma-Aldrich) for 2 min and alkylated with 20 mM chloroacetamide (CAA) for 30 min at room temperature. Next, 1,000 µg of magnetic SP3 beads (1:1 hydrophobic:hydrophilic) (Cytiva) was added to each sample along with 100% liquid chromatography (LC)–MS-grade ethanol (Sigma-Aldrich) to reach the final concentration of 50% ethanol. The samples were then incubated for 30 min with KingFisher Flex system (Thermo Fisher Scientific) at room temperature. The beads were washed three times with 80% high-performance LC (HPLC)-grade ethanol (Sigma-Aldrich) and resuspended with 150 µl of trypsin/Lys-C (4 µg, Thermo Fisher Scientific) in 200 mM EPPS (pH 8.4)/5 mM CaCl2 (Sigma-Aldrich), and proteins were digested overnight for 16 h at 37 °C. A speedvac with 5% acetonitrile and a small amount of formic acid was used to reconstitution the Digested peptides. Peptides were eluted with 80% acetonitrile/0.1% formic acid, dried by a Speedvac. 10 g of the reconstituted acetonitrile/0.1% formic acid had their Peptides labelled with 50 g of the anti-accumulation reagent from each channel. The reaction was quenched by the addition of 5% hydroxylamine and 10% formic acid. The samples were then pooled and dried using a Speedvac.

In the acidic pH LC–MS/MS analysis, each fraction from basic pH LC was dried by a Speedvac and was run sequentially on a column (75 µm × 35 cm for the whole proteome, 50 µm × 30 cm for whole proteome, 1.9 µm of C18 resin from Dr. Maisch, 65 °C to reduce backpressure) interfaced with a Fusion mass spectrometer (Thermo Fisher) for the whole proteome where peptides were eluted by a 90 min gradient (buffer A: 0.2% formic acid, 5% DMSO; buffer B: buffer A plus 65% acetonitrile). Mass spectrometry (MS) settings included the MS1 scan (450–1600 m/z, 60,000 resolution, 1 × 106 automatic gain control and 50-ms maximal ion time) and 20 data-dependent MS2 scans (fixed first mass of 120 m/z, 60,000 resolution, 1 × 105 automatic gain control, 110-ms maximal ion time, higher-energy collisional dissociation, 36% normalized collision energy, 1.0 m/z isolation window with 0.2 m/z offset and 10-s dynamic exclusion).

The computation of identification and quantification was done with a search engine. All original target protein sequences were reversed to generate a decoy database that was concatenated to the target database. To reduce the false discovery rate below 1%, the psms were used to group them by ion charge state and J Score, and then the score was used to find the offending psms. If one peptide could be generated from multiple homologous proteins, on the basis of the rule of parsimony, the peptide was assigned to the canonical protein form in the manually curated SwissProt database. If no canonical form was defined, the peptide was assigned to the protein with the highest PSM number. We performed the analysis in the following steps, which we noted in our previous reports: 1) extract TMT reporter ion intensities of each PSM; 2) correct the raw intensities on the basis of the isotopic distribution of each labelling reagent. We also performed y1ion-based correction of the data. See Supplementary Data 1.

An empirical Bayes-moderated test was used to compare treatment groups with the limma R package. The lower the percentile of the means of the expression, the lower the proportion of samples that were found to have low expression. As a result, 7,731 out of 11,428 proteins were retained for further analysis. Criteria for differential expression included a P value < 0.01 and a fold-change greater than 1.5. volcano plots were created by using the R package ggplot2. The environment used was R. The networks were built using a confidence threshold greater than 0.7. The resulting networks were imported and visualized using Cytoscape (v.3.5.10). Interaction data were sourced from text mining, experiments and existing databases. See Supplementary Data 1 and 2.

MOLM-13 (ATCC) and SET-2 (DSMZ) cells were a gift from M. D. Shair. HEK293T cells (Thermo Fisher Scientific) were a gift from B. E. Bernstein. Gesicle Producer 293T cells were a gift from D. R. Liu (Takara, 632617). MV4;11 and K562 cells were obtained from ATCC. The cells were obtained from a laboratory. All mammalian cell lines were cultured in a humidified 5% CO2 incubator at 37 °C and routinely tested for mycoplasma (Sigma-Aldrich). 100 U grams of penicillin and 100 g liters of Strepomycin were added to the media. MOLM-13, MV4;11 and K562 cells were cultured in RPMI1640 (Gibco) supplemented with 10% FBS. SET-2 cells were cultured in Gibco supplemented with 20% FBS. HEK293T and Gesicle Producer 293T cells were cultured in DMEM (Gibco) supplemented with 10% FBS. The HEK293F cells were cultured in a room with no lights or air conditioning. Spodoptera frugiperda (Sf9) insect cells (Expression Systems, 94-001F) were cultured in ESF921 medium (Expression Systems) in a non-humidified and non-CO2 incubator at 27 °C shaking at 140 rpm. High Five and ExpiSf9 cells were purchased from Thermo Fisher Scientific (B85502 and A35243, respectively), with Grace insect medium (Thermo Fisher Scientific, 11595030) supplemented with 10% FBS (Cytiva) and 1% penicillin–streptomycin (Gibco), cultured at 26 °C. All of the cell lines were authenticated by short tandem repeat profiling (Genetica) and routinely tested for mycoplasma (Sigma-Aldrich).

For lentivirus production, transfer plasmids were co-transfected with GAG/POL and VSVG plasmids into 293T cells using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s protocol. Medium was exchanged after 6 hours, and the viral supernatant was collected 52 hours later. The cells were transduced by spinfection at a temperature of 37 C and 5 g ml1 polybrene. Where necessary, 48 h after transduction, cells were selected with 1 µg ml−1 and 2 µg ml−1 puromycin (Thermo Fisher Scientific), respectively, for 3–5 days. For inducible expression experiments, K562 cells were selected with or 600 µg ml−1 geneticin (G418 sulfate) (Thermo Fisher Scientific) for 7–10 days.

The cloned library was called pSMAL mCherry. The backbone was created by using a BamHI restriction site instead of the two that were used in the original. The backbone was digested with BamHI (NEB) and subsequently treated with Antarctic phosphatase (NEB) and the correct linearized backbone was isolated by gel electrophoresis and purified using Gel DNA Recovery Kit (Zymo). Then, 190 ng of linearized vector and 13.15 ng of each sub pool were used for each Gibson reaction of 80 µl using HIFI DNA Assembly Master Mix (NEB). The experiment was started at 50 C and then the isopropanol precipitation regenerated the genes into Lucigen Endura Competent Cells. Cells were grown overnight at 30 C and plated after being recovered for 1 h in a recovery media. The plasmid library was prepared using a QIAGEN kit. The final library and sequence were verified using an Illumina MiSeq after the Purified sub pools were combined.

All KBTBD4 expression plasmids encoded isoform 1 (human, residues 1–518) but longer isoform 2 (residues 1–534) numbering was used. CoREST expression genes have full lengths (Rs 4–485). Open reading frames (ORFs) of human KBTBD4 and CoREST (mammalian expression) were amplified from ORFs obtained from Horizon Discovery. R. Shiekhattar is a professor in the University of Miami Miller School of Medicine. HDAC1 is full length. A gift from E. Verdin was the ORF. The coding sequence of HDAC2 was synthesised. The coding sequence of full length NUDCD3 (human, residues 1–361) was synthesized by Twist Biosciences.

eVLPs were produced as previously described22. At a density of 5 106 cells per flask, Gesicle Producer 293T cells were seeded in T-75 flasks. After 20–24 h, a mixture of plasmids expressing VSV-G (400 ng), MMLVgag–pro–pol (3,375 ng), MMLVgag–3xNES–ABE8e (1,125 ng) and an sgRNA (4,400 ng) were co-transfected into each T-75 flask using jetPRIME transfection reagent (Polyplus) according to the manufacturer’s protocols. At 40–48 h after transfection, producer cell supernatant was collected and centrifuged for 10 min at 4 °C and 2,000g to remove cell debris. A 0.45 m filter was used to remove the clarified eVLP-containing supernatant. Ultracentrifugation concentrated the supernatant using a cushion of 20% (w/v) sucrose in PBS. The SW28 rotor was used to perform ultracentrifugation at 26,000rpm for 2 hours at 4 C. After ultracentrifugation, eVLP pellets were resuspended in cold PBS (pH 7.4). eVLPs were frozen and stored at −80 °C. eVLPs were frozen before use, so there was no freeze-thaw.

The K562 cells were plated in 96-well plates with 5 g of polybrene and were used for transduction. BE-eVLPs were added directly to the culture medium in each well. After 6 h, 50 l of medium was added, and another 100 l was added after 48 h. Then, 72 h after transduction, cellular genomic DNA was isolated and genotyped as described below. Transduced cells were allowed to recover for 7–10 days before degradation assays were performed.

For cell viability assays, ICB1299, CHLA-01-MED and MED411FH-TC were transduced with eVLPs and cultured in Stem cell media. Cells were collected on day 3 for genotyping. Cell viability was measured on the 4th, 3rd, and 10th of April using a cell viability test. Relative growth was determined using end point readings from 7 days of culture. Stem cell media was used for five days to cultured ICB1299 cells before they were taken for immunoblotting or genotyping. Supplementary Table 2 has primer information for genotyping.

Genomic DNA was extracted using QuickExtract DNA Extraction Solution (Biosearch Technologies) according to the manufacturer’s protocol. We subjected 100 ng of DNA to a first round of PCR (25–28 cycles, Q5 hot start high-fidelity DNA polymerase (New England Biolabs)) to amplify the locus of interest and attach common overhangs. The first round of amplification of the product was done in a single cycle and the next in a double cycle. Supplementary Tables 2 and 3 contain Primer Sequences. Final amplicons were purified by gel extraction (Zymo) and sequenced on an Illumina MiSeq. Data were processed using CRISPResso2 (ref. 52) using the following parameters: –quantification_window_size 20 –quantification_window_center -10 –plot_window_size 20 –exclude_bp_from_left 0 –exclude_bp_from_right 0 Averagereadquality 30 –nprocesses 12

The linker-FJP12V-2xHA-P2A-PuroR cassette was inserted into the C of HDAC2 in order to generate the GFP K562 cells. sgRNA (sgRNA: GGTGAGACTGTCAAATTCAG) (Synthego) targeting the C terminus of HDAC2 was electroporated according to the manufacturer’s protocol (Neon Transfection System, Thermo Fisher) with a repair vector containing the linker-FKBP12F36V-2xHA-P2A-PuroR CDS flanked by 700–800 base pairs of genomic homology sequences to either side of the HDAC2 C terminus. The cells were washed twice and then resuspended in buffer R with the sgRNA and repair bug added to it. Cells were immediately transferred to warm media. After ten days of recovery cells were selected with 2 gml1 puromycin from the freezer and sorted on a MoFlo Astrios EQ Cell Sorter. Single-cell clones were validated by Sanger sequencing and western blot.

The cells were generated as described. Point mutations and clone constructs were used to introduce the overexpression constructs into coding regions. Lentiviral particles carrying the overexpression constructs were produced and used to transduce K562 KBTBD4-null CoREST–GFP cells as described above. After 48 h, cells were treated with a combination of UM171 and DMSO. The FACS gating schemes were observed for mCherry+ cells in each condition. 1c.

A recombinant CoREST–HDAC complex was composed of full length LSD1, HDAC1, and N-terminally truncated Co. The pcDNA3 vector was used to create plasmids encoding the different proteins. The CoREST constructs contained an N-terminal (His)10(Flag)3 tag followed by a TEV protease cleavage site. In order to grow HEK 293F cells, the constructs for ternary complex had to be transfected with POLYethylenimine and collected after 48 h. Cells were resuspended in a lysis buffer and sonicated. The lysate was clarified bycentrifugation at 12,000g before being put into a container of Anti-FLAG M2 affinity gel. The affinity gel was washed twice with lysis buffer and twice with SEC buffer (50 mM HEPES, pH 7.5, 50 mM KCl, 0.5 mM TCEP) After the TEV protease overnight at 4 C. The complex was further purified with a Superose 6 10/300 column. The purity of the complex was verified by SDS–PAGE and fractions with 90–95% purity were pooled and supplemented with 5% glycerol and stored at −80 °C.

Sf9 insect cells were used for purification of human KBTBD 4 for biochemical and physical analyses. cDNAs for human KBTBD4 and NUDCD3 proteins were cloned into the pFastBac donor vector and the recombinant baculoviruses were constructed using the Bac-to-Bac protocol and reagents (Thermo Fisher Scientific). KBTBD4 constructs were tagged on the N terminus with 6×His cleavable by TEV protease. The plasmids were used to prepare separate baculoviruses according to standard protocols. The baculoviruses was determined using the detection ofgp64. The density of Sf9 cells was 106 cells per liter, co-developed with NUDCD3 and 2 baculoviruses at a single MoI of 3.5 and a separate MoI of 3.5, respectively. The cells were put into a 72 h incubator before being collected and frozen for future purification. Cells were resuspended in the lysis buffer. The Tris-HCl is cold, 500 mM. 1 mM NaCl. TCEP, 10% of glycerol, 15 mM imidazole, 1 mM PMSF and cOmplete were added to the cocktail. The lysates were clarified by centrifugation to 100,000g. The Superflow affinity is made from Ni Superflow. Resin was washed with lysis buffer containing a stepwise gradient of 15–50 mM imidazole, followed by elution using lysis buffer with 250 mM imidazole. The eluate was exchanged into storage buffer (50 mM Tris-HCl, pH 8.0 cold, 150 mM 1 mm is NaCl. TCEP, 10% glycerol) using an Econo-Pac 10DG desalting column (Bio-Rad) and further purified by size-exclusion chromatography using the Superdex 200 10/300 GL column (GE Healthcare). The purity of the recombinant protein was verified by SDS–PAGE and fractions with 90–95% purity were pooled and stored at −80 °C.

The fluorescein labelling of the LSD1–CoREST–HDAC1 complex was purified as described above. A Cys point mutagenesis has been conducted next to the TEV protease cleavage site of N-terminally truncated CoREST for the ligation reaction with NHS-fluorescein54. A 2 mM NHS-fluorescein was incubated with 500 mM mercaptoethanesulfonate (MESNA) in the reaction buffer (100 mM HEPES, pH 7.5, 50 mM KCl, 1 mM TCEP) for 4 h at room temperature in the dark for transesterification. After being washed with a reaction buffer, the FLAG M2 affinity gel was put into a solution with TEV protease for 5 h at 4 C. The complex was mixed with 500 l of the fluorescein solution to make a final concentration. The mixture was incubated for 48 h at 4 °C in the dark. The complex was further isolated by the use of a Superose 6 10/300 column in size exclusion chromatography. The labelling efficiency of lyscein was analysed using the amerham typhoon lea 9500. The purity of the complex was verified by a reagent, and fractions with greater than 90% purity pooled and supplemented with 5% glycerol, were stored at 80 C.

The ubiquitination assay for white microtitre plates based on the TR-FRET and UM171 settings for low-volume plates

Experiments were performed in either the white,384-well microtitre plates or the white,372-well low-volume microtitre plates. The following settings for TR-FRET were used on the Tecan SPARK plate reader, with the following: 340/50-nacelle, 490/10-nacelle and 520/10-nacelle. If you want a dichroic 510 mirror, you can use the 50% mirror, unless you specify otherwise. The 520/490-nm intensity ratio was used to calculate the TR-FRET ratio.

In order to make it a one-to WT 6 His–KB TBRD4 (40 nM), fluorescein-labelled LSD1–CoREST–HWAC complex (40 nM) and anti-5His IgG (20 nM) 33 were allDiluted. NaCl, 1 mM TCEP, 10% glycerol) and LHC buffer (20 mM HEPES, pH 7.5, 1 mM 10 l was added to wells of a white, low-volume microtitre plate with or without 100 M SAHA. The TR-FRET was taken before UM171 was added using a D300 digital dispensers and allowed to equilibrate for one h at room temperature. Data were background-corrected from wells containing no UM171. Prism 9 was used to fit the data to a four-parameter dose–response curve.

The ubiquitination assays were set up similarly to as previously reported55. In a total volume of 20 l, reactions were performed at 37 C. The reaction mixtures contained 5 mM ATP, 100 μM WT ubiquitin, 100 nM E1 protein, 2 μM E2 protein, 0.5 μM neddylated RBX1-CUL3, 0.5 µM There’s a station called WT. or PRkbbd4 has 25 mM. Tris-HH 7.5, 20 mM. NaCl, 10 µM InsP6 and 2.5 mM MgCl2 as reaction buffer. The reaction mixture was prepared at 37 C for 5 minutes and then added E1 to start the reaction. The SDS loading buffer containing reducing agent -mercaptoethanol was added to quench the reactions. The reaction samples were resolved on SDS–PAGE gels and analysed by Colloidal Blue staining, western blots or Typhoon fluorescent imaging.

The library was designed to include all possible deletions, 1-amino acid substitution, 3-amino acid substitution and 2-amino acid substitution. The 5′ and 35′ arms were added, as well as the forward and reverse barcodes for the different sub pools of mutations. The library was ordered from Twist Biosciences as a pooled oligo library with the final lengths ranging from 101 to 113 nucleotides. The Twist pool was resuspended in tris-edTA to a concentration of 1 ng l1 and the sub pools were separated using lsPCR1 primer as template. Each sub pool was further amplified with lsPCR2 primers in Supplementary Table 5 by PCR amplification of 10 cycles and the library pools were gel purified (Zymo Gel DNA Recovery Kit). Oligos corresponding to 2–6-amino acid deletions were ordered from Sigma-Aldrich and cloned separately from the Twist pool (Supplementary Data 3).

We analysed data using Python (v.3.9.12) with Biopython (v.1.78), Pandas (v.1.5.1) and NumPy (v.1.23.4). The raw reads matching the sequence from unsorted as well as sorted cells were counted. Counts were then processed by converting them to reads per million, adding a pseudocount of 1 and transforming them by log2. The enrichment of each variant in GFP+ and GFP populations was quantified by subtracting the log2transformed counts for unsorted cells and averaged across replicates. The heatmaps were created using matplotlib.

Position probability matrices of the GFP+ and unsorted populations were constructed for each mutually exclusive category (single substitution, single insertion, double substitution and double insertion) by normalizing raw counts by the total read counts of each corresponding category, averaging across replicates and tallying the probability of every amino acid at each position. The information content, IC, of each position N was calculated according to Kullback–Leibler divergence, which is as follows:

The position probability matrix of the unsorted population was used as background frequencies, while the position probability matrix of the GFP+ population was used. Logos were generated using Logomaker (v.0.8)56.

Cryo-EM studies of KBTBD4+UM171-LHC PDX tumours harbouring the HDAC1/2 inhibitor RBC1HI

MB PDXs harbouring WT KBTBD4 (RCMB28 n = 3, MED411FH n = 2) or KBTBD4-PR mutant (ICB1572 n = 5) were used to assess sensitivity to the HDAC1/2 inhibitor RBC1HI. The PDX tumours were cut into small pieces and put into a papain solution for 30 minutes. LS003126) containing N-acetyl-l-cysteine (160 μg ml−1, Sigma-Aldrich, catalogue no. The catalogue of A9165 and DNase I is from the archives of Sigma-Aldrich. dissociation by gentle pipetting to single cells. After 2 min at 37 C, the red blood cells were removed from the suspension by rinsing in DPBS-BSA. The viability of the cells were assessed using a 40-m strainer, and were found to be over 80%. Cells were plated at 1,000 cells per well in 384-well plates in Stem cell media. The cells were quickly added to a final concentration of 40–0.006 M in order to get rid of the serially-Diluted RBC1HI. The viability of the cell at the end of the incubation process was measured using a microplate reader. The data was analysed using a data analyser and converted to raw values and then dose–response curves were generated.

To assemble the complex of KBTBD4–UM171–LHC for the cryo-EM study, the individually isolated KBTBD4 protein and co-expressed LHC complex were mixed in stoichiometric amounts with 1 μM UM171 added and subsequently applied to the Superose6 increase gel-filtration column (Cytiva) in a buffer containing 40 mM HEPES, pH 7.5, 50 mM KCl, 100 µM InsP6 and 0.5 mM TCEP is a type of phosphine. The isolated complex was then cross-linked with 37.5 mM glutaraldehyde at room temperature for 6 min and quenched with 1 M Tris-HCl pH 8.0. The cross-linked sample was snap-frozen for future use.

To prepare grids for cryo-EM data collection, a QuantiFoil Au R0.6/1 grid (Electron Microscopy Sciences) was glow discharged for 30 s at 20 mA with a glow discharge cleaning system (PELCO easiGlow). There was 3.0 l of the purified and crosslinked complex applied to a glowing substance. After being immersed in the chamber at 10 C and relative humidity of 100%, grids were blotted for 3 seconds with a blotting force of zero, then frozen in liquid ethane with the aid of the Mark IV system fromThermo Fisher. Data collection of KBTBD4-PR–LHC and KBTBD4-PR–HDAC2–CoREST was carried out on an FEI Titan Glacios and Krios transmission electron microscope (Thermo Fisher) operated at 200 kV and 300 kV, respectively, at the Arnold and Mabel Beckman Cryo-EM Center of the University of Washington. An automation scheme was implemented using the SerialEM software using beam-image shift at a nominal magnification of 105 K, resulting in a physical pixel size of 0.84 Å. The images were acquired on a K3 camera direct detector. The dose rate was set to 10 e− Å−2 s−1, and the total dose of 50 electrons per Å2 for each image was fractionated into 99 electron-event representation frames. The data collected from the Krios transmission electron microscope was put to use at the HHMI Janelia Research Campus. An automation scheme was implemented using the SerialEM58 software using beam-image shift59 at a nominal magnification of 165 K, resulting a physical pixel size of 0.743 Å. The images were acquired on a Falcon 4i camera direct detector, with the slit width of Selectris X (Thermo Fisher) set to be 6 eV. The dose rate was set to 15.39 e− Å−2 s−1, and the total dose of 60 electrons per Å2 for each image was fractionated into 60 electron-event representation frames. Data were collected in four sessions with a defocus range of 0.8–1.5 μm. In total, 6,839 and 8,414 videos were collected for KBTBD4-PR–LHC and KBTBD4-TTYML–HC, respectively. For KBTBD4-PR–HDAC2–CoREST, data were collected in four sessions with a defocus range of 0.8–1.8 μm. In total, 11,263 videos were collected.

For all three complexes, videos were collected and imported into CryoSPARC60 followed by patch motion correction and patch the contrast transfer function (CTF) estimation. Micrographs were manually inspected after they had been sieved with CTF parameters. In order to be considered particles, they were further analyzed and subjected to two-dimensional classification. The particles were selected and subjected to an initio reconstruction after being cleaned. Particles were used for Heterogenous Strengthening. After one extra round of cleaning up by heterogenous refinement, particles from good reconstruction were selected to get re-extracted without Fourier cropping. The overall resolution is achieved by Homogenous and non-uniform refinements. Local refinement resulted in a better map for the KELCH-repeat domain, as a soft mask was applied to the KELCH domain. For a second round of Ab initio construction, more particles were picked by the top hat picker. The data processing details can be found in the extended data figs.

Bead-bead synthesis and cloning of anti-K–GG peptides using the UbiFast method

The UbiFast method is used for the enrichment of K–GG. For each sample, 500 µg peptides was reconstituted in 250 µl HS bind buffer (Cell Signaling Technology) with 0.01% CHAPS. Reconstituted peptide was added to 5 µl PBS-washed HS anti-K-ε-GG antibody bead slurry (Cell Signaling Technology, 59322) in a 96-well KingFisher plate (Thermo Fisher Scientific). The plate was covered with foil and incubated for 1 h at 4 °C with end-over-end rotation. The plate containing the anti-K–GG bead was processed on the KingFisher Flex. In brief, bead-bound enriched peptides were washed with 50% acetonitrile/50% HS wash buffer followed by awash in PBS. K-ε-GG peptides were labelled while on-bead with freshly prepared 400 µg TMTpro reagents (Thermo Fisher Scientific) in 100 mM HEPES for 20 min and labelling was quenched with 2% hydroxylamine. The beads were washed with a buffer before being put into PBS. All sample wells were combined, the supernatant was removed and enriched K-ε-GG peptides were eluted from the beads with 2 × 10 min 0.15% TFA. The eluate was desalted using C18 StageTips, frozen and dried in a vacuum centrifuge.

CoREST (full-length and truncated), MIER1 and RCOR2 inserts were PCR-amplified with Esp3I sites and ligated into a Cilantro 2 eGFP-IRES-mCherry reporter vector by golden-gate assembly. Point mutations were introduced into coding regions using standard PCR-based site-directed mutagenesis techniques. Deletion constructs were made by amplification of genes and then cloned into a Cilantro 2 vector with the help of a New England biolabs. The Lentiviral particles were produced and used in a procedure to transduce the cells. Then, 48 h after transduction, cells were selected with 1 µg ml−1 puromycin for 3–5 days. The cells with UM171 were then treated with the same concentration for 6 or 24 h. The mean of the geometric mean of the ratio of GFP to mCherry was calculated using the NovoExpress software. The ratios for the individual drug-treated samples were normalized to the ratios of the DMSO-treated samples in Microsoft Excel (v.16.80) and plotted using GraphPad Prism (v.9.4.0). All degradation assays were done in triplicate and FACS-gating schemes are shown in Supplementary Fig. 1a.

Source: UM171 glues asymmetric CRL3–HDAC1/2 assembly to degrade CoREST corepressors

Bioassays of the depsipeptides Fmoc-Thr(OtBu)-glycolic acid and preparation of H3K9ac(1-34) for nucleo

MST assays were performed with the Monolith NT.115 (NanoTemper) system using the Nano BLUE mode. The exciting laser power was set for 50% and the medium MST had been set. KD values were calculated using MO.analysis (v.2.3) software with the quadratic equation binding KD model shown below:

is related to the word frac( A_rmT+B_)

The depsipeptide as Fmoc-Thr(OtBu)-glycolic acid was synthesized based on a reported two-step protocol61. The H3K9ac(1–34) with the sequence as ARTKQTARKS-TGGKAPRKQL-AT KAARKSAP-A- TOG-G was synthesized by a standard solid-phase peptide synthesis. Novabiochem bought the Fmoc-Lys(Ac)- OH (EMD Millipore 852042). F40 sortase was expressed and purified as reported previously, and bacterial expression and purification of Xenopus laevis globular H3 (gH3; amino acids 34–135 C110A) were performed also according to a previous protocol61. Next the F40-sortidase-catalysed histone H3 reaction was performed between the H3K9ac and the gH3. The reaction mixture was purified by ion-exchange chromatography to obtain pure semisynthetic histone H3K9ac (C110A) characterized by MALDI-TOF MS as reported previously62.

The previous methods used for the re assembly63 were used to prepare the 146 -150 -110 bp widom 601 DNA. Bacterial expression and purification of X. laevis core histones H2A, H2B and H4 were then carried out, followed by assembly of the histone octamer and refolding as previously reported64. The octamer was purified by size-exclusion chromatography using the Superdex 200 10/300 GL column (GE Healthcare) and was used for nucleosome assembly with 146 bp 601 Widom DNA as reported previously65. The final mixture was subjected to HPLC purification (Waters, 1525 binary pump, 2489 UV-Vis detector) with a TEKgel DEAE ion-exchange column to purify the final nucleosome product. The H3K9ac nucleus was analysed by the native TBE-gel with EtBr staining and then by anti-H3K9ac antibodies65 using the western blotting technique.

Source: UM171 glues asymmetric CRL3–HDAC1/2 assembly to degrade CoREST corepressors

Measurement of sgRNA in a microtitre plate using HEPES, Tween-20, KCl, 75 mg mLBH589, MAZ1600 and 7-Amino-4

Recombinant HDAC1 (BPS Bioscience 50051) or HDAC2 (BPS Bioscience 50002) were diluted to 6 nM (1.2×) into buffer containing 50 mM HEPES, pH 7.5, 100 mM KCl, 0.5 mg ml−1 BSA, 0.001% Tween-20 and 25 μl added to wells of a white, 384-well microtitre plate (Corning 3572). Test compounds were added in serial dilution (1:2 titration, 15-point, cmax = 10 μM) using a D300 digital dispenser (Hewlett-Packard), and allowed to equilibrate for 1 h at room temperature. The final HDAC1/2 concentration 5 nM and the final MAZ1600 concentration 18 M were added, and the activity was allowed to continue for 45 min. Next, 5 μl of 7× developer solution was added (150 nM trypsin + 40 μM LBH589 final concentrations) and the plate was incubated for 30 min at room temperature. 7-Amino-4-methyl coumarin fluorescence was measured on the Tecan Spark plate reader: 350/20 nm excitation, 460/10 nm emission. The background was defined by the 10 M LBH589 dose and the ceiling was defined using a no-inhibitor control. The data was background-corrected and normalized before being fit to a four-parameter dose–response curve.

Data analysis was done using a number of libraries, including Python, SciPy, and NumPy. sgRNA enrichment was calculated using the previous description. In brief, sequencing reads matching each sgRNA were quantified as reads per million, increased by a pseudocount of 1, log2-transformed, normalized to the plasmid library and replicate-averaged. The GFP+ abundances were normalized to unsorted abundances. The normalized log2[fold change in sgRNA enrichment]) is the mean value for non-targeting controls and was subtracted to calculate the final enrichment value. sgRNAs with zero counts in the plasmid libraries were excluded from further analysis.

Per-residue sgRNA enrichment scores were estimated as previously described45. In brief, LOESS regression was performed on using the lowess function of the statsmodels package (v.0.13.5) in Python (v.3.9.12) with a 20 amino acid sliding window (‘frac = (20 AA/L)’, where L is the total length of the protein), and ‘it = 0’ to fit observed log2[fold change in sgRNA enrichment], hereafter the sgRNA enrichment score, as a function of amino acid position. The onlyRNAs that were used were those that are predicted to bring about missense changes. For amino acid positions that were not targeted by sgRNAs, enrichment scores were interpolated by performing quadratic spline interpolation on the LOESS output scores using the interp1d function of the SciPy package (v.1.10.0).